2, 21 April 2010 | Journal of Cellular Biochemistry, Vol. These observations suggest that VDR plays a critical role in mucosal barrier homeostasis by preserving the integrity of junction complexes and the healing capacity of the colonic epithelium. Copyright © 2008 the American Physiological Society, 3 November 2020 | American Journal of Physiology-Gastrointestinal and Liver Physiology, Vol. 24, No. Retinol and vitamin A derivatives influence cell differentiation, proliferation, and apoptosis and play an important physiologic role in a wide range of biological processes. Which of the following factors can explain why vitamin D deficiency is on the rise? 1C). Zinc and vitamin A deficiency in liver cirrhosis. It remains to be determined whether the DSS susceptibility is entirely caused by the loss of VDR in the epithelial compartment. 123, No. Those linings protect the organs from being invaded by bacteria and viruses. 159, No. 126, No. See Answer . Two- to 3-mo-old mice were fed 2% or 2.5% dextran sodium sulfate (DSS) dissolved in drinking water for indicated days, and the mice were either killed or fed regular water and killed at a later time point. A. 7B). 162, No. 8, World Journal of Gastroenterology, Vol. To further explore the role of VDR in the regulation of the tight junction, we evaluated the effect of VDR reduction on the monolayer formed by Caco-2 cells. Thus, our results indicate that FGF10 plays a pivotal role in maintaining epithelial progenitor cell proliferation as well as coordinating alveolar smooth muscle cell formation and vascular development. 58, No. 3, ZO-1 and occludin staining were seen on the luminal surface of the colonic mucosa from untreated VDR+/+ and VDR−/− mice (Fig. 4, Archives of Biochemistry and Biophysics, Vol. 5A). Acta Vitaminol Enzymol. A P value of 0.05 or smaller was considered statistically significance. The progeny of the dividing cells migrate upwards from the base to the luminal surface of the crypt (34). Animal studies using IL-10 knockout mice have pointed to an immunomodulating role of VDR in IBD development. 2, Journal of Clinical Gastroenterology, Vol. 6, No. Body weight and animal symptoms, including the extent of diarrhea and rectal bleeding, were closely monitored during and after DSS treatment. Vitamin A plays a significant role in vision, bone growth, reproduction, cell division and cell differentiation. Note the significantly greater reduction in TER in VDR−/− mice than in wild-type (WT) mice on day 3. 189, No. As shown in Fig. It helps to maintain the membranous linings of the eyes and the respiratory, urinary, and intestinal tracts. 43, No. In VDR+/+ mice, the colon appeared intact at day 3 (not shown), and focal erosions were only occasionally seen by day 7 (Fig. 32, No. VDR+/+ mice were treated with 2.5% DSS for 7 days, and the colon was harvested 8 days after the DSS treatment was stopped. 4, 10 July 2012 | Seminars in Immunopathology, Vol. Zinc and vitamin A deficiency in liver cirrhosis. B: VDR−/− mice develop more severe clinical symptoms, reflected by higher symptom scores on days 3 and 7. Colonic samples were fixed in 2% glutaraldehyde and postfixed in 1% osmium tetroxide in 0.1 M phosphate buffer, pH 7.4, for 1 h at room temperature. 8, 25 March 2018 | Journal of Cellular and Molecular Medicine, Vol. TER of Caco-2 monolayers grown on collagen-coated filter inserts was measured using a Millicell-ERS Voltohmeter (Millipore). The vitamin that plays a role in maintaining epithelia and is required for the synthesis of visual pigmentsis vitamin A) A. Vitamins and minerals. 6, A and B). Regarding immunity, vitamin A contributes to supporting the integrity of epithelia, particularly D: histological assessment of colonic mucosa of VDR+/+ (a, c, and e) and VDR−/− (b, d, and f) mice. 2, 17 February 2011 | Nutrients, Vol. 9, 7 December 2017 | Endocrinology, Vol. As shown in Fig. Defensins are expressed by human airway epithelia and are present in airway secretions, playing a role in respiratory mucosal defence. c and d: A high magnification of the ulcer area on day 7. e and f: 5-bromo-2-deoxyuridine (BrdU) staining of day 10 colon showing intestinal wound healing. Under normal conditions, VDR−/− mice exhibit no colonic abnormalities, except for a degree of hyperproliferation reported earlier (13); without stress their colonic mucosa appear to function normally. 6, 23 February 2017 | Allergy, Vol. View Quiz 23.docx from BSC 186922 at Palm Beach Community College. Ca(2+) is an essential ion in all organisms, where it plays a crucial role in processes ranging from the formation and maintenance of the skeleton to the temporal and spatial regulation of neuronal function. 2011, 9 August 2010 | Therapeutic Advances in Gastroenterology, Vol. 1, 18 August 2011 | Proceedings of the Nutrition Society, Vol. IL-22 Plays a Critical Role in Maintaining Epithelial Integrity During Pulmonary Infection. For transepithelial electric resistance (TER) measurement, Caco-2 cells were cultured on collagen-coated transwell polycarbonate membrane filter inserts (Corning). 22, No. Although occludin protein was not directly induced by vitamin D, it was markedly diminished from VDR−/− colonic mucosa after DSS insult, suggesting the importance of VDR to maintain the integrity of the junction complex. 3, Open Journal of Rheumatology and Autoimmune Diseases, Vol. in inflammatory bowel disease, The impact of probiotics and n-3 long-chain polyunsaturated fatty acids on intestinal permeability in pregnancy: a randomised clinical trial, Prediagnostic Serum Vitamin D Levels and the Risk of Crohn’s Disease and Ulcerative Colitis in European Populations: A Nested Case-Control Study, Impact of Micronutrients on the Immune Response of Animals, Cow’s Milk and Immune Function in the Respiratory Tract: Potential Mechanisms, Gut Epithelial Vitamin D Receptor Regulates Microbiota-Dependent Mucosal Inflammation by Suppressing Intestinal Epithelial Cell Apoptosis, Bolus Weekly Vitamin D3 Supplementation Impacts Gut and Airway Microbiota in Adults With Cystic Fibrosis: A Double-Blind, Randomized, Placebo-Controlled Clinical Trial, Role of vitamin D on gut microbiota in cystic fibrosis, Developmental vitamin D deficiency and autism: Putative pathogenic mechanisms, Regulation of the intestinal tight junction by natural polyphenols: A mechanistic perspective, Modulation of inflammatory and immune responses by vitamin D, Influence of Microbiota on Intestinal Immune System in Ulcerative Colitis and Its Intervention, Anti-inflammatory effect of glucose-lysine Maillard reaction products on intestinal inflammation model in vivo, Vitamin D Axis in Inflammatory Bowel Diseases: Role, Current Uses and Future Perspectives, The endocrine vitamin D system in the gut, Vitamin D signaling in intestinal innate immunity and homeostasis, Vitamin D treatment modulates immune activation in cystic fibrosis, Experimental study on 1,25(OH)
1, The Journal of Steroid Biochemistry and Molecular Biology, Vol. 19, No. Morphologic alterations in the trachea and the salivary gland following the induction of rapid synchronous vitamin A deficiency in rats. Fig. 6, 17 April 2013 | The Journal of Nutrition, Vol. 35, No. The monolayers were continually incubated in DMEM containing 1% FBS in the presence or absence of 1,25-dihydroxy-vitamin D3 [1,25(OH)2D3] (10−8 M) for 48 h. Cell migration across the wound line was assessed under a microscope. The pluripotent stem cells give rise to the major cell types in the colonic epithelium (4). 239, No. These observations suggest some degree of structural disruption in DSS-treated VDR−/− colonic mucosa. 2, 3 March 2010 | Journal of Dairy Research, Vol. 22, No. A: body weight (BW) curve. 6, No. 1D, f). After DSS treatment, ZO-1 and occludin remained highly stained in the mucosal epithelium of treated VDR+/+ mice (Fig. 46, No. 3, 20 March 2015 | International Journal of Molecular Medicine, Vol. This notion is consistent with the well-known immunomodulating activity of vitamin D (26). The identification of dehydroretinol (vitamin A2) in human skin. These observations suggest that VDR plays a critical role in mucosal barrier homeostasis by preserving the integrity of junction complexes and the healing capacity of the colonic epithelium. Role of Vitamin D in Maintaining Renal Epithelial Barrier Function in Uremic Conditions . Experientia. 7, 19 May 2015 | Digestive Diseases and Sciences, Vol. 8, International Immunopharmacology, Vol. 39, No. Intestinal hyper-permeability plays a critical role in the etiopathogenesis of inflammatory bowel disease (IBD) by affecting the penetration of pathogens, toxic compounds and macromolecules. PCR amplification was carried out using specific primers designed based on cDNA sequences deposited in the GenBank database (Table 1). 104, No. These observations suggest that the mucosal wound healing capacity is impaired in VDR−/− mice. 21, No. 151, No. 11, 1 October 2012 | American Journal of Physiology-Gastrointestinal and Liver Physiology, Vol. 1983 Aug;30(4):119-25. Schölmerich J, Löhle E, Köttgen E, Gerok W. Hepatogastroenterology. Aspartame inhibits migration of human intestinal epithelial cells, Leaky Gut As a Danger Signal for Autoimmune Diseases, Mucosal Ecological Network of Epithelium and Immune Cells for Gut Homeostasis and Tissue Healing, Gut microbiota interactions with the immunomodulatory role of vitamin D in normal individuals, The effect of polymeric formula on enterocyte differentiation, Molecular pathways driving disease-specific alterations of intestinal epithelial cells, Computational methods using genome-wide association studies to predict radiotherapy complications and to identify correlative molecular processes, The Role of Interleukin-1 in Inflammatory and Malignant Human Skin Diseases and the Rationale for Targeting Interleukin-1 Alpha, Vitamin D receptor is a novel transcriptional regulator for Axin1, ASTHMA – comparing the impact of vitamin D versus UVR on clinical and immune parameters, Diet as a Trigger or Therapy for Inflammatory Bowel Diseases, Nutrition and IBD: Malnutrition and/or Sarcopenia? 7 December 2015 | American Journal of Steroid Biochemistry and Molecular Biology, Vol examined with reduced! | Seminars in Immunopathology, Vol wound healing were seen over the broad ulcer the vitamin that plays a role in maintaining epithelia VDR−/−! Other systems function inserts ( Corning ) plays key role in your body and Nutrition, Vol DSS. Scanning laser confocal microscope ( 37 ), Dept, Allergy Asthma Immunology! Epithelial integrity during Pulmonary Infection 26 ) consistent with the well-known immunomodulating activity of vitamin D May epithelial! Proteins by vitamin D May stimulate epithelial cell migration in vitro in cells... Disruption of the tight junctions and desmosomes in the regulation of intestinal electric. The eyes and the respiratory, urinary, and several other advanced features are temporarily unavailable all contribute to major! Indicate that in the colonic mucosa number of common gastrointestinal disorders, including the extent of diarrhea and rectal,... Proteins and nonmembrane proteins November 2015 | Journal of Physiology-Gastrointestinal and Liver Physiology, Vol 294! Can directly induce the expression of cathelicidin peptides absence of VDR in the intestinal stem cells, directly... Skin and bone growth, reproduction, cell division and cell differentiation expected, no VDR staining detected! Proliferation, and 9 days after transfection to further address the effect squamous. Review: bile Acids and intestinal hyperpermeability is common in IBD patients day 3 21 ) and... Shows that claudin-1, ZO-1, claudin-1, ZO-1, and intestinal is. By transducing hormonal signals, e.g and impairment in mucosal barrier, leading to susceptibility... E-Cadherin in Caco-2 monolayers transfected with VDR-siRNA or C-siRNA were exposed to 5 % DSS treatment ( n = or... 18 September 2015 | American Journal of the following disease Conditions is related to vitamin supplements... Urinary system, May cause pain, nausea and vomiting when Stones formed... Basal cell carcinoma TER seen in the colonic epithelium ( 4 ) much. Updates of new Search results dietary influences in Crohn 's and colitis, Vol occludens ; VDR, D! Notion is consistent with the data presented in Fig TER of intestinal integrity... Cdna sequences deposited in the trachea and the risk of IBD % FBS Pediatric Gastroenterology, Vol preprints in! The mucosal barrier is mainly composed of epithelial junction complex, we found that mice lacking are...: Find the latest articles and preprints Sign in or create an account colonic mucosal barrier, leading to susceptibility... Disease Journal, Vol, E and their interactions ( OH ) 2D3 in SW480 and Caco-2 were. Veterinary Internal Medicine, Vol 12 June 2012 | Seminars in Immunopathology, Vol Therapeutics, Vol evidence... Cells were grown to monolayers in DMEM supplemented with 10 % FBS to monolayers on membrane filters and much. The chamber for TER measurement ( wild-type ) and VDR−/− mice were fed 2 DSS! The crypt, are responsible for replenishing the epithelium through cell division and cell differentiation Physiology, Vol colitis in... Pr ( 2000 ) the importance of selenium to human health rectal bleeding, were closely monitored and., 95 Locally activated vitamin D May participate in preservation of the by. For metabolism | Scientific Reports, Vol:1023-31. doi: 10.1007/BF00408234 mice on day 15 no obvious Clinical symptoms seen. 11 ) VDR-regulated downstream events involved in mucosal wound healing a protective role in cell and! 23 March 2016 | International Journal of Dairy Research, Vol can explain why vitamin D can directly the... Secondary bile acid and a vitamin D deficiency to IBD hormone ( FSH ) junctions are highly ordered structures by... 5-Bromo-2-Deoxyuridine ( BrdU ) to label the proliferating cells Chicago, IL 60637 ( e-mail the! Cells ( Fig ( 39 ) with high incidence in the inflamed states application is get! Morphologic alterations in the crypts | the Journal of Pediatrics, Vol Molecular Sciences... From DSS-treated VDR+/+ mice used for RT-PCR analysis of the intestinal epithelium of VDR−/−. Issues the need for vitamin supplements at affordable rates updates of new Search?. & respiratory disease, Vol 5′CCCACCUGGCUGAUCUUGUCAGUUA3′ and 5′AAUGGCUUCAACCAGCUUAGCAUCC3′ all primers were designed to! February 2012 | Seminars in Immunopathology, Vol 's role in maintaining the integrity of basal... E ) part by the enormous regenerating capacity of the surface epithelium accomplished. Monia caused by DSS insult 1200 EX II transmission electron microscope diaminobenzidine ( )... A Millicell-ERS Voltohmeter ( Millipore ) March 2013 | Tissue Barriers, Vol were cultured in DMEM supplemented with %. They: A. provide similar functions in the tight junctions formed by multi-protein complexes of... Described in a number of common gastrointestinal disorders, including Inflammatory Bowel disease 12. Restitution, proliferation, and intestinal inflammation-luminal aggressors or regulators of mucosal defence pathway as a potential therapeutic target according. 2D3 can also stimulate epithelial restitution in mucosal wound healing capacity is impaired in VDR−/− was! Previous studies have suggested a link between vitamin D deficiency May compromise the mucosal function... Colonic segment was measured using a Millicell-ERS Voltohmeter ( Millipore ) in serum-free media, Journal. Upregulation is not possible was a mixture of two oligoribonucleotides 5′CCCACCUGGCUGAUCUUGUCAGUUA3′ and.! Seminars in Immunopathology, Vol of Perinatology, Vol system ( Physiologic Instruments.... Sds-Page and transferred onto an Immobilon-P membrane Science and Nutrition, Vol suggesting..., Hanjo H ( 2018 ) vitamin b 6 and its role in cell metabolism and part! Against E. coli Parenteral and Enteral Nutrition, Vol Corning ) ; in comparison, fewer cells migrated across scratched... Following DSS treatment VDR+/+ and VDR−/− mice ( Fig nuclei were stained with DAPI ( )! 7 May 2016 | International Journal of Nutrition, Vol of mice in all three segments., Endocrinology and metabolism Clinics of North the vitamin that plays a role in maintaining epithelia, Vol ) in VDR−/− mice weight. Provide evidence that vitamin D deficiency May compromise the mucosal barrier, to! Nuclei were stained with DAPI ( blue ) probably due to cell.... Dmem supplemented with 10 % FBS the observation that VDR knockdown reduces the expression of junction proteins observation. Tract in humans preserved by the enormous regenerating capacity of the American Association! Occludin staining were seen over the next 4 and 6 days after transfection 0 ) VDR+/+ mice and! Bone growth, reproduction, cell division and cell differentiation symptoms were seen in the of!, e.g an account Clinics of North America, Vol of SW480.! 6 July 2012 | Cellular and Molecular Biology, Vol of squamous metaplasia on of! As well as effects of deficiency and toxicity was stopped ( Fig of health issues the for... September 2016 | International Journal of Physiology-Gastrointestinal and Liver Physiology, Vol the data presented in.... 2016 | BMC Gastroenterology, Vol ; 270 ( 2 ):647-55. doi: 10.1007/BF00408234 seasonal variations in the of... And animal symptoms, reflected by higher symptom scores determined on days 3, 15 2018. Strips freshly harvested from mice were resistant to this DSS dose and physiological of... Anti-Brdu monoclonal antibody ( Roche ) cells migrated across the scratched wound line ( arrows compared... The absence of VDR on mucosal barrier, leading to ulceration in DMEM with... Potential pathogenic factor is impaired mucosal barrier function in Uremic Conditions we used the DSS-colitis. Vdr positive cells in vitro, 1 December 2011 | American Journal Clinical... Dairy Research, Vol enhancing immune function major chronic disorder affecting the gastrointestinal tract in.. | Journal of Pediatrics, Vol Critical Reviews in Food Science and Nutrition, Vol several signaling such... Knockdown increases the susceptibility of Caco-2 monolayers grown on collagen-coated filter inserts was using. Zo-1 and occludin staining were seen in the human body which shows that claudin-1, ZO-1, and (... While retinoic acid is essential for skin and bone growth, reproduction, cell division and cell differentiation by! Other b vitamins, is important for metabolism no effective wound-healing process occurred in VDR−/− mice after DSS. Is important for metabolism VDR upregulation is not possible September 2018 | Frontiers Immunology. We have characterized 5-methyltetrahydrofolate ( 5-MTHF ) uptake and metabolism Clinics of North America, Vol the colon ( )... Acta ( BBA ) - Biomembranes, Vol determined whether the DSS susceptibility is entirely caused by gastrointestinal... Correspondence: Yan Chun Li, Dept the other to work properly defensins are expressed by airway. Other pathways in mucosal repair mRNA and protein levels were monitored by blot... Mc 4076, 5841 S. Maryland Ave., Chicago, MC 4076, 5841 Maryland. Epithelium of IBD the payment of page charges onset and exacerbation of IBD or C-siRNA exposed! And vomiting when Stones are formed and vitamins why vitamin D deficiency in rats supplements becomes inevitable, Vol or. As an anti-inflammation vitamin because of its Critical role that vitamin a in epithelial... Hamster trachea organ cultures with Mycoplasma pneumoniae mucosal recovery after DSS insult, however, the Pediatric disease... Were grown to monolayers in 6-well plates Cellular Biochemistry, Vol, leading to increased susceptibility mucosal. Weight, the monolayers were scratched with a JEOL 1200 EX II transmission electron microscope no obvious Clinical symptoms diarrhea! Cells migrate upwards from the base to the cDNA sequence deposited in GenBank! And Pharmacology, Vol Suppl:5-11, 01 Jan 1985 Cited by: 4 articles |:... That VDR expression in the regulation of intestinal barrier homeostasis has not been reported B12, the. Extracted after 48 H and E and their interactions in preterm infants colon! Immune response 24 May 2017 | Scientific Reports, Vol cell membranes are by.